Наноструктурированные стеклокерамические покрытия для ортопедических применений - часть 3


2.2. Прочность сцепления и микротвердость

   Прочность на разрыв при растяжении между покрытием и   подложка   было   измеренный   в   соответствие   с   ASTM   С-633-79.     тестирование   процедура   Можно   быть   найденный   в   наша предыдущая работа [ 32 ]. Пять образцов были протестированы независимо   за   каждый   тип   из   покрытия   а также     Результаты   были сообщены   как   среднее ± sd

Микротвердость покрытий была испытана на полированных поверхностях покрытия с использованием микротвердого тестера Shimadzu (Shimadzu Co., Japan) с нагрузкой 300 gf и     погрузка   время   из   15 с.   До   тестирование,   покрытия   были подвергнуты   в   определяем   полировка.   твердость   ценности   были зарегистрированы   на   15   разные   позиции.  

  Результаты   представлены   как   имею в виду ± sd

 


Таблица 1. Праймеры, используемые для маркеров, относящихся к RT-PCR-HOB.


ген

последовательность   ( 5 '   - 3 ' )

температура плавления (℃)

GAPDH

F ACCCAGAAGACTGTGGATGG

60


R CAGTGAGCTTCCCGTTCAG


Runx-2

F ATGCTTCATTCGCCTCAC

60


R ACTGCTTGCAGCCTTAAAT


OPN

F TTCCAAGTAAGTCCAACGAAAG

60


R GTGACCAGTTCATCAGATTCAT


коллаген типа I

F AGGGTCCCAACGAGATCGAGATCCG

60


R TACAGGAAGCAGACAGGGCCAACGTCG


БСП

F ATGGCCTGTGCTTTCTCAATG

60


R GGATAAAAGTAGGCATGCTTG


 


2,3. Ионные и бесклеточные минерализационные испытания

     Чтобы измерить поведение ионного релиза покрытий HT и SP, их погружали в течение 7 дней в 15 мл раствора хлорида натрия (рН 7,4), забуференного трис (гидроксиметил) аминометаном и хлористоводородной кислотой (раствор HCl-Триф-буфера). После вымачивания измеряли значения рН буферизованного раствора, а концентрации ионов тестировали методом атомно-эмиссионной спектроскопии с индуктивным пуском во главе (ICP-OES, Optima 3000 DV, США).

Способность покрытий индуцировать осаждение соединений Са и фосфора (Р) оценивали путем погружения покрытий в культуральную среду, не содержащую клеток. Вкратце, покрытия стерилизуют путем погружения в 70-процентный раствор этанола в течение ночи и затем промывают забуференным фосфатом физиологическим раствором (PBS) перед вымачиванием в культуральной среде. Три миллилитра культуральной среды добавляли в каждую лунку 12-луночного культурального планшета, содержащего образцы покрытия. Образцы покрытия инкубировали при 37 ° С в увлажненной 5% -ной атмосфере СО 2 в течение 5 ч, а затем промывали сверхчистой водой, сушили и распыляли на угле для наблюдения СЭМ. Химический состав отложений, сформированных на поверхности покрытия после минерализации, анализировали с использованием энергодисперсионной спектроскопии (ЭДС), которая была прикреплена к прибору SEM.


2,4. Выделение и культура первичных остеобластов человека

Разрешение на использование отброшенных человеческих тканей было предоставлено Комитетом по этике человека Университета Сиднея и получено информированное согласие. Первичные остеобласты человека (HOB) были выделены из нормальной трабекулярной кости человека, как описано ранее [34]. Вкратце, кость была разделена на части размером 1 мм3, несколько раз промывалась в PBS и переварена 0,02% (мас. / Об.) Трипсина (Sigma-Aldrich, США) в PBS, pH 7,4, в течение 90 минут при 37 ℃. Затем клетки культивировали в полной среде, содержащей минимальную существенную среду (a-MEM, Gibco Laboratories, США), дополненную 10% (об. / Об.) Инактивированной теплом сывороткой теленка плода (FCS, Gibco Laboratories), 2 мМ L-глутамин (Gibco Laboratories), 25 мМ буфера Hepes (лаборатории Gibco), 2 мМ пирувата натрия, 30 мг мл -1 пенициллина, 100 мг / мл стрептомицина (Gibco Laboratories) и 0,1 мМ фосфатной магниевой соли L-аскорбиновой кислоты ( Wako Pure Chemicals, Осака, Япония). Клетки культивировали при 37 ℃ в атмосфере 5% CO 2, и среды обновляли каждые три дня. При слиянии клетки пассировали, а в прохождении 3 - в экспериментах.



2.5. Прикрепление клеток и морфологическое наблюдение

После того, как клетки достигли слияния 80-90%, они были подвергнуты триполизации с использованием TrypLE Express (Invitrogen), затем центрифугировали и суспендировали в полной среде для получения клеточной суспензии с плотностью 3,4 × 10 4 клеток на миллилитр. Затем в каждую лунку 24-луночного планшета для клеток, содержащего образцы покрытия, добавляли 1 мл клеточной суспензии. После культивирования в течение 2, 5 и 24 ч клетки фиксировали в 4-процентном растворе параформальдегида, после чего фиксировали, используя 1 процент тетраоксида осмия в PBS в течение 1 часа, а затем обезвоживали в серии гранулированного этанольного раствора (30, 50, 70, 90, 95 и 100%) и, наконец, сушат в гексаметилдисилизане в течение 3 мин. Образцы высушенного покрытия были распылены золотом перед наблюдением SEM.



2.6. Анализ пролиферации клеток

Для определения количества жизнеспособных клеток использовали колориметрический метод CellTiter 96 A Water Assay (Promega, США). Анализ представляет собой объединенный раствор соединения тетразолия 3- (4,5-диметилтиазол-2-ил) -5- (3-карбоксиметоксифенил) -2- (4-сульфофенил-2Н-тетразолия) (МТС) и электронного связывающего реагента (феназин метосульфат) с объемным соотношением 20: 1. Бывшее соединение может быть биоокислено жизнеспособными клетками в формазан, который растворим в клеточной культуральной среде. Таким образом, поглощение формазана при 490 нм прямо пропорционально числу жизнеспособных клеток. Четыре образца каждого типа покрытий тестировали на каждый момент времени, а диски без покрытия Ti-6Al-4V использовали в качестве контроля. Вкратце, 1 мл клеточной суспензии с плотностью клеток 8,5 × 10 4 клеток мл -1 добавляли в каждую лунку 24-луночного планшета для культивирования, содержащего образцы покрытия. Через 3 и 7 дней культуральную среду заменяли 700 мкл рабочего раствора МТС, который представлял собой пятикратно разбавленный раствор водного анализа CellTiter 96 в PBS. Через 4 ч дополнительной инкубации 100 мл рабочего раствора переносили в 96-луночный планшет для культивирования клеток для измерения поглощения с помощью микропланшетного считывателя (PathTech) при 490 нм.


2,7. Количественная полимеразная цепная реакция в реальном времени

HOB засевали на образцы покрытия с плотностью ячейки 2 × 10 4 клеток см -2 и культивировали в течение 1 дня и 7 дней. После каждой временной точки суммарную РНК выделяли d из HOB, культивированных на образцах покрытия и контрольных образцах непокрытых дисков Ti-6Al-4V , используя Trizol (Sigma) в соответствии с инструкциями производителя. Первичная кДНК была синтезирована из 0,7 мкг общей РНК с использованием набора Omniscript RT Kit (Qiagen, США) в соответствии с инструкциями производителя. Затем кДНК анализировали с помощью ПЦР в реальном времени (Rotor-Gene 6000, Science Life Corbett) для генов, связанных с остеобластом: Runx-2, коллагена I типа, остеопонтина (OPN) и костного сиалопротеина (BSP) и их относительной экспрессии гена уровни были получены путем нормализации глицеральдегид-3-фосфатдегидрогеназы (GAPDH).

Праймеры, используемые для выбранных генов, перечислены в таблице 1.


2,8. статистический анализ

Данные были получены из четырех независимых экспериментов и выражены как среднее ± sd. Для статистического анализа использовалась программа SPSS 17.0. Тест Левэна проводился для определения однородности дисперсии для всех данных, а затем для данных с однородной дисперсией использовались пост-hoc-тесты Tukey HSD, в противном случае использовался T2 post hoc Tamhane.

Значение p менее 0,05 считалось значительным.



******продолжение следует******